Biohybrid nanomaterials: bioinspired, DNA- and peptide-based assemblies for sensing, delivery and electronics

Resume : Peptide and polymer hydrogels are receiving increasing attention as substrates for biomedical applications, such as soft injectable networks in regenerative medicine. Despite their advantages, covalently crosslinked polymer hydrogels lack biological functionality and responsiveness, which can be overcome by employing supramolecular peptide hydrogels with a sequenced-defined chemical structure. Here, we present a new approach to develop hybrid hydrogels by combining cationic polymer nanoparticles (NPs) and a phosphorylated tripeptide, Fmoc-FFpY, which interact electrostatically leading to the formation of supramolecular hydrogels. NPs, based on vinylimidazole and ketoprofen, a non-steroidal anti-inflammatory drug, inhibit the inflammatory marker expression up to basal values. Moreover, it is known that diphenylalanine based peptides possess anti-inflammatory properties. Different hydrogels were prepared by varying the concentrations of peptide (from 1 to 5 mg/mL) and NPs (from 0.01 to 0.05 wt%). Fluorescence spectroscopy was used to check the excimer formation of Fmoc moieties, a signature of the peptide self-assembly. Besides this, peptide self-assembly yields β-sheets, as revealed by Circular Dichroism, and a fibrillar gel network as observed by Cryogenic Transmission Electron Microscopy (Cryo-TEM). Rheological measurements proved the shear thinning behavior of the resulting hydrogels which can be used as injectable biomaterials. In vitro biological tests performed with human dermal fibroblasts (HDF) and RAW264.7 murine macrophages (RAW) cells show the non-cytotoxic effect of these hydrogels as well as HDF cell adhesion properties. Moreover, the obtained hybrid hydrogels show a synergistic anti-inflammatory response with the reduction of lipopolysaccharide-induced nitric oxide release of RAW cells. Degradation studies mimicking in vivo conditions were also performed. Overall, the supramolecular peptide/polymer nanoparticles based hydrogels show excellent chemical, mechanical and biological properties to be employed as injectable hydrogels for tissue engineering applications.

Resume : The development of new catalysts for oxidation reactions is of central importance for many industrial processes. Plasmonic catalysis involves photoexcitation of templates/chips to drive and enhance oxidation of target molecules. Raman-based sensing of target molecules can also be enhanced by these templates. This provides motivation for the rational design, characterization, and experimental demonstration of effective template nanostructures. We report here on a template comprising silver nanoparticles on aligned peptide nanotubes, contacted with a microfabricated chip in a dry environment [1]. Efficient plasmonic catalysis for oxidation of molecules such as p-aminothiophenol results from facile trans-template charge transfer, activated and controlled by application of an electric field. Raman detection of biomolecules such as glucose and nucleobases are also dramatically enhanced by the template. A reduced quantum mechanical model is formulated, comprising a minimum description of key components. Calculated nanotube-metal-molecule charge transfer is used to understand the catalytic mechanism and shows this system is well-optimized. Reference: Enhanced photocatalysis and biomolecular sensing with field-activated nanotube-nanoparticle templates, Nature Communications, DOI:10.1038/s41467-019-10393-9, 2019.

Resume : Short peptides that assemble into higher-order supramolecular nanostructures are emerging as functional biomaterials. They combine multiple beneficial aspects into a versatile materials platform. Peptides can be synthesized at scale with ease while maintaining near-perfect sequence control. The peptide sequence determines the type of nanostructure that is formed during assembly. Out of the resulting morphologies, nanofibers are of particular interest, as they resemble fibrous proteins of the extracellular matrix and can thus facilitate cell-material communication. Multifunctional materials become available either through co-assembly of different building blocks or through post-assembly reactions, enabling the introduction of tracer molecules, bioactive signals and other moieties. Here, we utilize self-assembling peptides to form dynamic particles, coatings and bulk hydrogels. By introducing pH- and light-responsive groups, we gain control over the assembly and disassembly behavior of bioactive nanostructures. Furthermore, patterned surfaces become accessible where the position and concentration of bioactive signals can be controlled externally. We have identified a number of peptide sequences that promote the growth of primary neuronal cells in vitro and lead to enhanced functional recovery in a peripheral nerve injury model in vivo. Finally, in bulk hydrogels, pH-responsive peptides were shown to act as supramolecular crosslinkers that give rise to remarkable rheological properties including thixotropy and self-healing.

Resume : Nature uses proteins for a variety of functions, and among all others, their ability to form high-hierarchical structures as well as to mediate charges (electrons, protons, and ions) across specific intra-protein pathways from the nm-scale up to the ?m scale. In our work, we are inspired by these functions of proteins in nature and utilize proteins for the formation of large-scale responsive materials. With this biological inspiration, we report here on a new family of conductive and free-standing biological materials, where we use proteins as building blocks to design various types of materials. With this in mind, we focus only on proteins that can be produced in bulk quantities and at low cost from raw materials, in which most of our work to date has been focused on the bovine serum albumin (BSA) protein. We show that using our designed (bio-)polymerization approach we can form large scale free-standing (self-supporting) and insoluble materials on the macroscale. Some of our protein-based polymeric materials possess a highly elastic nature, capable of stretching more than 5 times their length. Due to the relatively high water uptake of our protein-based polymers and the presence of many amino acid residues that can participate in hydrogen bonding, our new protein-based polymers showing good protonic and ionic conductivity. Following the formation of the biopolymer, we show that it can be further functionalized in different ways. For enhanced protonic conductivity we add oxo-acids to the polymer, resulting in measured ionic conduction of >10 mS/cm at room temperature. For enhanced electronic conductivity we can dope the formed polymer with natural electron mediating small molecules. For gaining new light-stimuli-responsive we attach to the protein-based polymer light-responsive molecules, resulting in the large light attenuation of its electrical properties. From a fundamental scientific perspective, the protein-based nature of our materials enables us to explore the governing factors and mechanisms of long-range biological charge transport. Nonetheless, our new protein-based biopolymers have several attractive properties for their possible integration in various applications. Our materials are environmentally friendly, they possess inherent biodegradability and biocompatibility, they have attractive mechanical properties, and their formation obeys most principles of green chemistry. From a practical point of view, we introduce here a very easy polymerization method that requires no synthesis, and it is energy efficient. Moreover, due to the low price-tag of our chosen proteins and the simple formation process, the cost of our new biopolymers can reach merely 1 USD for 100 cm2 of the final polymer. Currently, our main targeted application for our new family of materials is for biological interfaces, and we show their use in biosensing applications, while other lines of applications include the use of our biopolymers for biomedical applications (tissue engineering) and for energy applications such as membranes for fuel cells.

Resume : In regenerative medicine there is a need to create new biomaterials that can support cellular adhesion, growth, and differentiation to replace damaged tissue, while allowing for minimally invasive application to the site of injury. To meet these demands, we developed biohybrid materials consisting of a biopolymer backbone that is grafted with supramolecular gelators of either DNA or nanofiber-forming peptides, combining the stability of covalent bonds with supramolecular chemistry, which gives rise to the most advantageous features. Both types of hydrogels show remarkable material and biological properties, such as thixotropic behavior and biocompatibility. While the programmability of DNA is exploited to enable the controlled delivery of bioactive protein for cell population control yielding reduced osteoclast formation and resorption activity, the second set of hydrogels benefits from grafted peptides, which can undergo a triggered molecular rearrangement that induces self-assembly into nanofibers and subsequent gelation. The gels show exceptional self-healing properties and the supramolecular interactions of the peptides that crosslink the gel allow the material to flow under shear stress, immediately reforming the gel when the shear is removed. This enables the gel to be injected, thereby, minimizing damage to healthy tissue. Furthermore, the hydrogels are biocompatible and allow culturing of multiple cell types, including primary neuronal cells.

Resume : We report on the self-assembly of amphiphilic block copolymers into nanomedicines, mainly focusing on polymer vesicles, also referred as polymersomes, and their applications in loading and controlled release of both hydrophilic and hydrophobic molecules and biomolecules. We pay special attention to polysaccharide and polypeptide-based block copolymer vesicles and their development in nanomedicine. In this context, we developed synthetic strategies for the design of glycosylated polypeptides and polysaccharide-polypeptide biohybrids with controlled placement of sugar functionality. We were especially interested in designing amphiphilic copolymers able to self-assemble into well- defined micelles and vesicles that can advantageously be loaded with drugs and present a surface with multivalent presentation of bioactive saccharides or oligosaccharides. The ability of these nanoparticles for different biomedical applications, from drug-delivery to inhibitor, will be presented. We especially evidenced the particular benefit of nanoparticles and their multivalency toward the interaction with biological receptors. In order to get closer to the real structure of glycoproteins, we are moving from synthetic to genetically engineered polypeptides, focusing on post-modification of elastin-like proteins. Finally, our recent advances in using “biomimicry approaches” to design complex, compartmentalized and functional protocells will be proposed. Such a system constitutes a first step towards the challenge of structural cell mimicry and functionality, and may act in the future as an autonomous artificial cell that can sense and cure in situ any biological deregulation.

Resume : Our research group is interested in the application of supramolecular chemistry to understand and manipulate biology.[1,2] Our work philosophy is based in the importance of weak and non-covalent forces to control the shape and the topology of biomolecules, which are governed by the principles described by supramolecular chemistry. This topology is ultimately responsible of properties and function of biomolecules and organelles and thus we believe that by modulating the shape we can control and improve functional behaviour. With focus in supramolecular interactions for artificial membranes and tubular composites, we investigate the construction of synthetic systems for controlling and emulating biology and life-like soft systems.[3-5] Acknowledgements: AEI: [CTQ2014-59646-R, SAF2017-89890-R], the Xunta de Galicia (ED431C 2017/25, 2016-AD031 and 2016–2019, ED431G/09) and the ERDF). Ramón y Cajal (RYC-2013-13784), an ERC Starting Investigator Grant (DYNAP- 677786) and a YIG from the Human Frontier Science Research Program (RGY0066/2017). References [1] General review: A. Fuertes, J. Marisa, J. R. Granja, J. Montenegro, Chem. Commun. 2017, 53, 7861–7871. [2] Delivery review: I. Lostalé-Seijo, J. Montenegro, Nat. Rev. Chem. 2018, 2, 258–277. [3] Membrane transport and delivery applications: a) J. M. Priegue, D. N. Crisan, J. Martínez-Costas, J. R. Granja, F. Fernandez-Trillo, J. Montenegro, Angew. Chem. Int. Ed. 2016, 55, 7492–7495. b) I. Lostalé-Seijo, I. Louzao, M. Juanes, J. Montenegro, Chem. Sci. 2017, 8, 7923–7931. [4] Synthetic supramolecular biocomposites: a) I. Insua, J. Montenegro, J. Am. Chem. Soc. 2020, 142, 1, 300-307, b) A. Méndez-Ardoy, J. R. Granja, J. Montenegro, Nanoscale Horizons, 2018, 3, 391-396.

Resume : Supramolecular hydrogels formed through non-covalent interactions of low molecular weight hydrogelators (LMWH) show great potential applications in different fields. Generally, the self-assembly of LMWH is triggered by a sol-gel process through an external stimulus able to switch their solubility, such as temperature change, pH switch, solvent change, chemical and enzymatic reactions. In this work, we introduce a new strategy to trigger and control the self-assembly of Fmoc-FFpY peptides. The formation of the peptidic hydrogel is obtained instantaneously by direct electrostatic interactions with a polycation without dephosphorylation of the peptides. The resulting hydrogels show enhanced mechanical properties in comparison to gels of Fmoc-FFpY induced by enzymatic dephosphorylation. Peptide self-assembly yields beta-sheets, revealed by circular dichroism and infrared spectroscopy. Transmission electron microscopy and X-ray diffraction showed the fine structure of the self-assembled fibers. Geometry optimization calculations in the gas phase support a self-assembly model in which polycation chains interact with the peptides through their phosphate groups and the polycation/peptide entities form parallel beta-sheets and interact through their Fmoc groups in an anti-parallel manner. Characteristic distances predicted are in agreement with X-ray scattering data. This work opens a route towards a new class of self-assembled hydrogels, where Fmoc tripeptides self-assemble by their interaction with polycations. Since the gels form quickly and have superior mechanical properties, applications as injectable biomaterials are foreseen.

Resume : Oligonucleotides like siRNA have a high potential as therapeutic agents which is illustrated by the recent approvals of 3 drugs: Onpattro™ (2018), Givlaari™ (2019) and Oxlumo™ (2020). However, vectors are required to promote their transfection in cells and, unfortunately, cheap and versatile synthetic vectors have not yet delivered their promises.[1] An effective gene delivery vector should be able to complex effectively nucleic acids in biological fluids, pass biological barriers, and actively release nucleic acids inside the targeted cells. Thus, it is clear that smart dynamic vectors have to be developed in order to achieve such active delivery process which could rival viral vectors.[2] Our group has developed a strong interest in dynamic and adaptive vectors,[3] and in this context, we have been exploring the potential of dynamic covalent polymers.[4] More specifically, we recently studied a dynamic covalent library made of complementary peptide derivatives which are both water-soluble and cationic. Interestingly, we designed one of them to bear a clickable residue onto which targeting ligands can be grafted. While DCPs are traditionally formed only at high concentration – macrocycles of low valency unfit for nucleic acid recognition being preferentially formed at low concentrations – we found here that the presence of siRNA allows the in situ formation of DCPs in aqueous media at unusually low concentrations. More interestingly, using a glycosylated building block, we showed that siRNA-templated DCPs are capable of cell-selective siRNA delivery mediated through receptor-assisted endocytosis. This work shows the first example of a self-adapted siRNA vector which further promotes cellular uptake and cell-selective delivery through multivalent ligand display.[5] Overall, these results represent a stepping stone towards the self-fabrication of targeted nucleic acid vectors. [1] Ginn, S.L., Alexander, M.L., Edelstein, M.L., Abedi, M.R., Wixon, J.; J. Gene Med. 2018, 20, e3015. [2] S. Ulrich, Acc. Chem. Res. 2019, 52, 510 – 519 [3] E. Wagner, Acc. Chem. Res. 2012, 45, 7, 1005 – 1013 [4] a) D. Su, M. Coste, A Diaconu, M. Barboiu, S. Ulrich, J. Mater. Chem. B 2020, 8, 9385; b) C. Bouillon, D. Paolantoni, J. C. Rote, Y. Bessin, L. W. Peterson, P. Dumy, S. Ulrich, Chem. Eur. J. 2014, 20, 14705 – 14714; c) C. Bouillon, Y. Bessin, F. Poncet, M. Gary-Bobo, P. Dumy, M. Barboiu, N. Bettache, S. Ulrich, J. Mater. Chem. B, 2018, 6, 7239 – 7246 [5] N. Laroui*, M. Coste*, D. Su, L. Ali, Y. Bessin, M. Barboiu, M. Gary-Bobo, N. Bettache, S. Ulrich, Angew. Chem. Int. Ed. 2021, DOI: 10.1002/anie.202014066

Resume : Cateslytin (CTL) is an antimicrobial peptide derived from chromogranin A, protein of the stress response system. Their antimicrobial properties were thoroughly characterized and already exploited in biomaterials. However, effects on biofilms of yeast and bacteria have never been specifically addressed. We have investigated the impact of L and D configurations of CTL on the growth of biofilms formed by Candida albicans, Escherichia coli and Staphylococcus aureus. The study was conducted in different media and two strategies of treatment were tested, consisting of administrating the peptide either just at the beginning of biofilm development i.e. on just adhering pioneer microbial cells or on a biofilm already allowed to develop for 24h. We also considered whether the peptide was modified in contact with the medium or/and microbial metabolites. Significant effects were observed on planktonic and biofilm populations with both treatment strategies on all tested species. However, our results demonstrate that sessile microorganisms and biofilms are sensitive to CTL differently that planktonic populations, with inhibition concentrations from ten to eighty times higher than MICs determined in planktonic cultures, even stimulation of biofilm formation or, in contrast, better efficacy than antibiotics in some conditions. This confirms the high qualities of CTL as an antimicrobial and even anti-biofilm agent and specifies the conditions necessary to benefit of these properties.

Resume : Amyloid assemblies, which were historically associated with diseases, have recently been recognized as a biological structure that performs vital physiological functions in host organisms, highlighting their potential as life‐inspired nanoparticles, soft functional materials and matrices for biomedical applications. These organized proteinaceous assemblies combine many characteristics, including high mechanical resistance, biocompatibility, biodegradability, and thermal, chemical and enzymatic stability. In this regard, we are currently developing amyloid-like assemblies as self-adjuvanted nanocarriers for antigen delivery. Our strategy relies on the covalent attachment of an immunological epitope, or immunostimulator molecules, to a self-assembling peptide unit. Upon self-assembly of the chimeric peptide, tailored nanostructures displaying multiple copies of the epitope are obtained. This approach has led to the identification of effective fully synthetic nanovaccines against the influenza A viruses. Moreover, to address the inherent polymorphism and polydispersity associated with the process of amyloid formation, we recently developed strategies to control the final architecture of proteinaceous amyloid assemblies from the peptide sequence. This strategy opens to new directions for the usage of peptide nanoparticles and soft materials in vaccination and nanomedicine.

Resume : We are interested in how functionality emerges from sequence in ensembles of very short peptides, and subsequently how these functions can be incorporated into functional materials Instead of using sequences known in biological systems, we use unbiased computational and experimental approaches to search and map the peptide sequence space, which has provided new families of functional short peptides.[1-4] The talk will focus on our latest results in three areas. First, we will demonstrate how to program molecular order and disorder in tripeptides, and how the conformations adopted by these peptides can be exploited to regulate assembly properties, and give rise to tunable emission in the visible range. Second, we will demonstrate how dynamic exchange of peptide sequences can form adaptive libraries that provide insights into peptide sequences that can complex ligands.[5,6] Finally, we discuss peptide-based melanin mimics with tunable chromophoric properties that are achieved through oxidative incorporation of amino acids.[7] References: 1. A. Lampel, et al., Chem. Soc. Rev., 2018, 47, 3737-3758. 2. P.W.J.M. Frederix, et al., Nature Chem., 2015, 7, 30-37.  3. M. Kumar, et al. Nature Chem., 2018, 10, 696-703. 4. J. Son, et al., ACS Nano., 2019, 13, 1555-1562. 5. C.G. Pappas, et al., Nature Nanotechnol., 2016, 11, 960. 6. D. Kroiss, et al., ChemSysChem, 2019, 1, 7-11. 7. A. Lampel, et al. Science, 2017, 356, 1064.

Resume : The globular shape of gaseous ions, resulting from the ionization of large molecules such as polymers and proteins, is a recurring subject that has undergone a renewed interest with the advent of ion mobility spectrometry (IMS), especially in conjunction with theoretical chemistry techniques such as Molecular Dynamics (MD). Globular conformations result from a fine balance between entropy and enthalpy considerations. For multiply charged ions isolated in the gas phase of a mass spectrometer, the Coulombic repulsion between the different charges tends to prevent the ions from adopting a compact, and folded 3D structure. In the present paper, we closely associate data from IMS experiments and MD simulations to unambiguously access the conformations of dendrimer ions in the gas phase with special attention paid to the dendrimer structure, the generation, and the charge state. By doing so, we here combine a set of structural tools able to evaluate the (non)globular shape of ions based on both experimental and theoretical results. The study of dendrimer ions is the first step toward the characterization of the supramolecular complexes formed by electrostatic interactions between polyanionic nucleic acids and polycationic dendrimers called dendriplexes, in the context of gene delivery [1]. Reference 1. Dufès et al., Adv. Drug Deliv. Rev., 57, 2177-2202 (2005)

Resume : In this work, we assess the potential of cationic polythiophenes (CPTs) as optical transducers for the detection of enzymatic methylation of DNA. CPTs constitute an interesting class of π-conjugated polymers for biosensing applications, as they combine solubility in aqueous media and have sensitive optical properties for the detection of biomolecules such as DNA.(1) Recently, we have exploited “P3HT-PMe3”, an achiral polythiophene with phosphonium side-groups. When DNA and this polymer are mixed in aqueous solutions, self-assembly occurs and yield chiral supramolecular complexes, as observed by induced circular dichroism (ICD) signals in the spectral range where the polymer absorbs.(2,3,4) We study (chir)optical signals of the DNA/P3HT-PMe3 complexes for the detection of methylation of DNA catalysed by a methyltransferase (Mtase).(4,5,6) With long DNA, P3HT-PMe3 form µm-long fibers on surfaces, which are studied by Atomic Force Microscopy and Confocal Optical Microscopy.(7) (1) H. Jiang et al., Angew. Chem. Int. Ed. 2009, 48, 4300. (2) J. Rubio-Magnieto et al., Soft Matter 2015, 11, 6460. (3) M. Leclercq et al, ChemNanoMat, 2019, 5, 703. (4) M. Fossépré et al., ACS Appl. Bio Mater., 2019, 2, 2125. (5) Chris R. Calladine; Horace Drew; Ben Luisi; Andrew Travers, “Understanding DNA: The Molecule and How It Works”, Academic Press, 2004. (6) L. Fengting et al., Small, 2016, 12, 696. (7) R. Zhang et al, Sci. Rep., 2017, 7, 5430.

Resume : Peptoids are peptide reigioisomers that represent a class of peptido-mimetic polymers.[1] Compared to peptides, the side chain is appended to the amide nitrogen instead of the α-carbon. Peptoids can form stable secondary structures in solution, mainly helical,[2] and some other specific structures.[2] Peptoids have been successfully tested as chiral selectors in chiral column chromatography,[3] with the helical structure supposed to be responsible for these properties. NMR and CD are currently the most widely used techniques to characterize peptoid secondary structures.[1-3] However, the structural information provided by these methods is averaged over all isomeric structures. In this context, Mass Spectrometry (MS) techniques, especially Ion Mobility MS (IMMS), represent a suitable method to investigate the relationship between primary and secondary structures when coupled to calculations to assess their actual conformations.[4] We report here the study of peptoids by associating ion mobility mass spectrometry and molecular dynamics simulations [5,6]. In particular, we will discuss whether helicity is preserved when going from solution to the gas phase.[6] [1] N. Gangloff et al., Chem. Rev. 2016, 116, 1753 [2] K. Huang et al., J. Am. Chem. Soc. 2006, 128, 1733 [3] H. Wu et al., The Analyst 2011, 136, 4409 [4] J. De Winter et al., Chem. Eur. J. 2011, 17, 9738 [5] S. Hoyas, E et al., Biomacromolecules, 2020 (submitted) [6] S. Hoyas et al., Adv. Th. Sim., 2018

Resume : Immunotherapy is a type of treatment which uses the patient’s immune system to fight diseases such as cancer. Antibody-recruiting molecules (ARMs) constitute a promising class of molecular scaffolds in this field. These combine anchoring groups that target the surface of the cancer cells and haptens that bind endogenous antibodies, which are present in the serum, to trigger immune-mediated killing of target cancer cells. Multivalent ARMs, i.e. molecules that contain multiple haptens, revealed a better binding avidity towards the antibody in comparison to monovalent ARMs, and therefore may improve their therapeutic effect. In this work, we carry out molecular modelling simulations in order to get insights into the conformations and dynamics of specific ARMs, as well as their interactions with antibodies. Those simulations are performed with the GAFF2 forcefield in a water box model. Notably, we study the effect of the number of functional groups, their spacing, and the nature of the linkers on the conformation of ARMs as well as on their complexation to anti-DNP antibodies. The knowledge on the conformations and binding modes is fundamental to adapt the design of ARMs, to assess its binding to the antibody and thus improve its therapeutic effect. In particular, our results highlight the molecular parameters necessary to avoid the undesired interaction in between haptens on a single ARM.

Resume : Gold nanoparticles (AuNPs) can behave as nanosources of heat under light irradiation with a frequency close to the surface plasmon. This property is commercially exploited for biomedical applications. Most of studies conducted so far have sought to maximize the heating power per NP at λ > 700 nm by adjusting the characteristics of individual NPs. As pointed by simulations, another option consists to assemble NPs in colloidal oligomers. This approach could allow the use of small NPs with small absorption cross-section but with good biodegradability compared to usual NPs. Few experimental studies were done so far in this direction due to the difficulty to assemble NPs using biocompatible compounds in water. I will present a strategy to assemble AuNPs in colloidal oligomers by electrostatic complexation with quaternized chitosan. First, I will describe the structure and the photothermal properties of the complexes obtained by equivolumic mixing in the different regions of the state diagram. I will show that neutral complexes, with the least colloidal stability, present the best photothermal properties due to a minimized interparticle distance. Second, I will show that these neutral complexes could be stabilized, at different stages of their growth, by fast addition of polymer using a quench flow reactor allowing controlled mixing and delayed co-injection on a millisecond time scale. This method enables to rapidly produce stable suspensions of a few mL containing complexes with controlled aggregation number. Finally, in vitro experiments have been performed to appreciate their potential for photothermal therapy.

Resume : There is currently a crucial need of innovative multifunctional nanoparticles combining, in one formulation, imaging and therapy capacities allowing thus an accurate diagnosis and a therapy monitored by imaging. Multimodal imaging will ensure to speed up diagnosis, and to increase its sensitivity, reliability and specificity for a better management of the disease. Combined with a therapeutic action, it will also enable to treat the disease in a specific personalized manner in feedback mode. The mastered design of such bioprobes as well as the demonstration of their efficiency are still challenges to face in nanomedicine. In this work, novel fluorescent and magnetic core–shell nanocomposites have been designed to ensure, in one nanoformulation, bimodal fluorescence and MRI imaging coupled with therapy by magnetic hyperthermia. They consist in the coating of a magnetic iron oxide (IO) core (ca. 18 nm diameter to ensure magnetic hyperthermia) by an original large pore stellate mesoporous silica (STMS) shell to produce uniform and monocore magnetic core–shell nanocomposites denoted IO@STMS NPs. To confer fluorescence properties, CdSe/ZnS quantum dots (QDs) NPs were grafted inside the large pores ofthe IO@STMS nanocomposites. To provide biocompatibility and opsonization-resistance, a tightly-bound human serum albumin (HSA) coating is added around the nanocomposite using an original IBAM-based strategy. Cellular toxicity and non-specific cell–nanomaterial interactions allowed to determine a concentration range for safe application of these NPs. Cellular endosomes containing spontaneously-uptaken NPs displayed strong and photostable QD fluorescence signals while magnetic relaxivity measurements confirm their suitability as contrast agent for MRI. HeLa cell-uptaken NPs exposed to a magnetic field of 100 kHz and 357 Gauss (or 28.5 kA m−1) display an outstanding 65% cell death at a very low iron con-centration (1.25 microgram Fe mL−1), challenging current magnetic hyperthermia nanosystems. Furthermore, at the particularly demanding conditions of clinical use with low frequency and amplitude field (100 kHz,117 Gauss or 9.3 kA m−1), magnetic hyperthermia combined with the delivery of a chemotherapeutic drug, doxorubicin, allowed 46% cell death, which neither the drug nor the NPs alone yielded, evidencing thus the synergistic effect of this combined treatment.

Resume : Food security and the need to increase sustainably crop yields for a rapidly growing world population are among the greatest social and economic challenges of our century. The most extended agricultural practice to enhance crop yield is to increase host plant density, which in turn tends to increase the severity of plant diseases.1 Furthermore, globalization has contributed to the spreading of new pests into regions in which plants were not adapted, causing unaffordable agronomic losses. Most plant diseases occurring in agriculture are caused by fungal pathogens.2 Plant diseases caused by pathogenic bacteria are less prevalent; but their effects on agriculture are also devastating.3 In this work, we present an anti-bacterial and anti-fungal patch, which exploits the potential of smart-based nanomaterials as pesticides and silver nanoparticles (AgNPs) as anti-bacterial active component, improving the efficiency and environmental sustainability of pesticides application. In order to prevent the release of the NPs to the environment and their runoff loss during application, we attached the active silver nanoparticles to a bacterial cellulose (BC) matrix to obtain BC-AgNPs hybrid films. The bacterial cellulose matrix has similar chemical composition to the plant cellulose present in leaves but shows higher purity, crystallinity and water absorbance.4-5 We take advantage of the gel-like nature of the bacterial cellulose matrix to in situ synthesize and embed AgNPs. We evaluated the release and attachment of silver nanoparticles to a bacterial cellulose matrix and their in vitro anti-pathogenic properties against an array of plant pathogens with high agro-economical impact, such as the bacterium Pseudomonas syringae and the fungus Botrytis cinerea. These anti-bacterial and anti-fungal capacities were also assessed in vivo using the plant species Nicotiana benthamiana a close relative of tobacco and tomato; both widely used as a model organisms in plant biology.6 Insights of other applications on wound healing also will be provided. References (1) Sundström, J. F. et al. Future threats to agricultural food production posed by environmental degradation, climate change, and animal and plant diseases - a risk analysis in three economic and climate settings. Food Secur. 6, 201?215 (2014). (2) Agrios, G. N. Plant Pathology. Quinta edición. Academic Press. Nueva York. (2005). (3) V. Rajesh Kannan, K. K. B. Sustainable Approaches to controlling plant pathogenic bacteria. (2015). (4) Klemm, D. et al. Nanocelluloses: A new family of nature-based materials. Angew. Chemie - Int. Ed. 50, 5438?5466 (2011). (5) 5 Zeng, M., Laromaine, A. & Roig, A. Bacterial cellulose films: influence of bacterial strain and drying route on film properties. Cellulose 21, 4455?4469 (2014). (6)Enhancing Localized Pesticide Action through Plant Foliage by Silver-Cellulose Hybrid Patches A. Alonso-Díaz, J.i Floriach-Clark, J. Fuentes, M. Capellades, N. S. Coll, A. Laromaine; ACS Biomater. Sci. Eng., (2019), 5 (2), pp 413?419.

Resume : Nanostructured cobalt oxide (Co3O4NPs) is a material with a diversity of applications. Plant extracts can assist Co3O4NPs synthesis. The biomolecules in extracts contribute as a template for crystal growing and as reducing and capping agents. Co3O4NPs were synthesized from cobalt(II) nitrate hexahydrate in the pulp, and seed extracts of tomato (Solanum lycopersicum) and seeds of atemoya fruit (Annona squamosa L. x Annona cherimola Mill.) submitted to vigorous stirring, in alkaline medium, at room temperature. Atemoya and Tomato seeds are rich in oleic acid, whereas tomato pulp and seeds are rich in the iron storage protein ferritin. The ferritin content is higher in tomato seeds. Ferritin can contribute as a template for the crystal growing, and oleic acid is a capping agent for nanoparticle stabilization and biocompatibility. The synthesis of Co3O4NPs from tomato and atemoya seeds spent 16 and 60 days, respectively, and were confirmed by UV-visible spectroscopy, Tauc plot, and magnetophorese. The nanoparticles were further characterized by XPS (X-ray photoelectron spectroscopy), XRD (X-ray diffraction), FESEM-EDX (field emission scanning electron microscopy with energy dispersive X-Ray spectroscopy), and HRTEM (high-resolution transmission electron microscopy). Only the synthesis assisted by tomato seed extracts resulted in Co3O4 quantum dots (QDs) with a mean diameter of 4.5 +/- 0.5 nm. The formation of QDs was assigned to the high content of endogenous ferritin present in tomato seeds providing a nanocage for controlled crystal growing. The presence of oleic acid increased biocompatibility for the QDs evaluated by the plasmatic membrane permeabilization and mitochondrial transmembrane potential of keratinocyte HaCaT cultured cells (6,25.104 / mL). The results demonstrated that synthesis assisted by tomato seeds results in QDs feasible to be applied in technology and biology. Supported by FAPESP 2017/02317-2 and 2019/01425-1

Resume : The incorporation of two metallic nanoparticles (MNPs) into one system has enormous benefits in achieving advanced multifunctional nanomaterials in diverse applications such as catalysis, Surface-enhanced Raman Scattering (SERS), localized surface plasmon resonance (LSPR) sensors, and photothermal conversion [1]. Recently, an unprecedented approach known as Vapor Induced Phase Separation (VIPS) was developed for the fabrication of precisely shaped gold nanoparticles embedded in a poly (methyl-methacrylate) PMMA layer [2]. The main principle of this technique relies on the self-assembly of PMMA thin layer into nanoholes, which are used as MNPs synthesis reactors. Among several synthetic procedures, VIPS is considered as a powerful and simple route because it provides excellent control of structural properties of NPs. It offers compelling evidence for producing efficient SERS platforms with controlled size, shape, and interparticle gap distances [3,4]. Inspired by this approach, we aim to fabricate multifunctional hybrid nanomaterials such as Ag-Au bimetallic nanoparticles (BNPs). This is a new insight in the synthesis of BNPs by a surface-based strategy. Precisely, we carried out a parametric study dealing with the influence of different experimental parameters on optical and structural properties of BNPs. The optical properties of synthesized BNPs substrates were analyzed by micro-extinction and ellipsometric measurements. Ultimately, the significance of the present work lies in assuring the effectiveness of the substrates produced in SERS applications by inducing highly sensitive, stable, and reproducible SERS substrates over a large scale.

Resume : Surface nanopatterning allows a tight control of the surface’s topology with regular lattices from few to hundred nanometers. Such nanostructures are used for devices in the field of microelectronics, photovoltaic, biomedical and biosensors. Nowadays, the generation of well-organized lattices is mainly based on self-assembled molecules such as protein which have the ability to create a wide range of 2D lattices. However, these lattices present a thin height which limits their grafting capability and thereby their wider use in nanotechnological field. Here, we present a new self-assembled protein revealing a 3D honeycomb lattice based on the natural ability of the protein to self-assemble through head-tail interaction. Thanks to electron microscopy, we studied the behavior of the honeycomb self-assembly on carbon and SiO2 surfaces. AFM analysis revealed a height of 30 nm corresponding to 40 stacked protein. These characteristics make the assembly a potential grafting platform never described until now. Moreover, we also showed that the amino acid sequence of the protein can be modulate without altering the honeycomb structure paving the way to design adaptive self-assembled structure for nanotechnological purpose.

Resume : Recently, synthesized extended topological line defects in the graphene (ELDG) sheet has been found promising for bio-molecule sensing device applications. In this work, using the consistent-exchange van der Waals density functional (vdW-DF-cx) method, we have investigated the structural and electronic properties of the ELDG nanogap setup when a DNA nucleotide molecule is positioned inside the nanogap electrodes. The interaction energy (E_i) values indicate charge transfer interaction between nucleotide molecule and electrode edges. The charge density difference plots reveal that charge fluctuates around the ELDG nanogap edges adjacent to the nucleotides. This charge redistribution grounds the modulation of electronic charge transport in the ELDG nanogap device. Further, we study the electronic transverse-conductance and tunnelling current-voltage (I-V) characteristics across two closely spaced ELDG nanogap electrodes when a DNA nucleotide is translocated through the nanogap using a combination of density-functional-theory (DFT) and non-equilibrium Green’s function (NEGF) methods. Our outcomes indicate that the ELDG nanogap device could allow sequencing of DNA nucleotides with a robust and consistent yield, giving the tunneling electric current signals that differ by more/nearly 1 order of electric current magnitude for the different DNA nucleotides. Thus, we believe that the ELDG nanogap-based tunneling device can be promising for DNA sequencing.

Resume : Nanoporous materials are interesting due to their potential in science and industry applications, including development of new chemical and biological sensors, catalysts, delivery systems, optical devices and high quality filters. The combination of naturally occurred molecules and synthetic compounds allows obtaining new biohybrid nanoporous materials with exclusive and advantageous physical, chemical, mechanical properties. In this research, we report on the simple, runs at lower temperatures, and consumes less energy sol-gel synthesis of nanoporous silicas with covalently immobilized oligosaccharide units as supramolecular centers. Here, the unique ability of β-cyclodextrin to form inclusion complexes with different compounds, combined with hexagonally ordered mesoporous structure of silicas, offers attractive opportunities. β-Cyclodextrin is one of three naturally occurring cyclodextrins, formed by seven α-1,4-D-glucopyranoside units resulting in a toroid structure with interior hydrophobic cavity and exterior hydrophilic rim. Introduction of β-cyclodextrin into the silica framework was made via coupling of oligosaccharide with (3-aminopropyl)triethoxysilane with activating agent participation, and the following condensation of synthesized silane with tetraethyl orthosilicate in the presence of template. The successful incorporation of cyclic units was verified by means of FT-IR spectroscopy, thermogravimetric and chemical analysis. The structure of obtained nanoporous materials was characterized by nitrogen adsorption-desorption measurements, powder X-ray diffraction, transmission electron microscopy, and dynamic light scattering. It was found that the enhancement of ethoxysilyl constituent in β-cyclodextrin-silane used in sol-gel condensation leads to the formation of silicas with higher content of oligosaccharide groups as well as less arranged mesopores. To elucidate a contribution of β-cyclodextrin as supramolecular centers into the properties of synthesized nanoporous hybrid materials, the sorption of benzene and phenol from aqueous solutions on pristine MCM-41 and β-cyclodextrin-functionalized MCM-41 silicas was studied as a function of time and equilibrium concentration. The higher adsorption performance of obtained nanoporous materials towards benzene and their adsorptive affinity to phenol can be useful in the selective removing of toxic aromatics from aqueous solutions. The proposed supramolecular approach of the synthesis of silicas with oligosaccharide units may be applicable for obtaining nanoporous materials with high affinity to aromatics in water treatment or sensing technology.

Resume : Chirality is ubiquitous in Nature, from living organisms to biomolecules, and influences fundamental processes that involve intermolecular interactions. Interestingly, many of these biological processes are based on cell proliferation and migration, that both take place in interaction with proteins of the extracellular matrix (ECM). While various physico-chemical cues of the cell microenvironment have been studied extensively, the influence of the ECM chirality on the cellular migration has been overlooked. To explore this issue, we propose to use multi-hierarchical self-assembly of (oligo)peptides to design well-defined in vitro migration assays. By using this multidisciplinary approach, we will investigate the effect of chirality, from the molecular to the supramolecular level, on the migration of epithelial cells in 2D and 3D microenvironments. We aim at understanding how molecular and supramolecular chirality can modulate integrin-based mechanotransduction mechanisms involved in cell migration.

Resume : Our studies reveal novel utilization of the multisine impedance spectroscopy to detect subtle interactions of selected macromolecules. The developed technique is efficient when operating in potentiodynamic, potentiostatic, or galvanostatic polarization modes. In potentiodynamic mode, the method was used to detect the DEFB1 gene collected from saliva samples efficiently. After the functionalization procedure with complementary oligonucleotide sequence, the anchoring and hybridization of this gene were identified by altering the charge transfer phenomena and frequency dispersion of capacitance effect. The above occurs due to modification of the anchored dsDNA orientation in the induced electric field. The multisine impedimetric probing utilized in galvanostatic mode allows practical flow injection tests and the identification of charge transfer mechanism alteration by changes in the analyte concentration or various environmental factors.

Resume : Arguably one of the biggest advances within the treatment and management of disease is the advent of molecular biology. Drug molecules are now developed with a specific molecular target in mind, and treatment decisions are underpinned by information obtained from molecular based diagnostics, such as biochemical analysis and polymerase chain reaction (PCR). Despite these advances, imaging modalities, for which many treatment decisions are based upon, are currently not able to accurately convey information at the molecular level. Our understanding of cancer pathology revolves around understanding the molecular composition of a tumour[1,2]. Despite anticancer drugs being the most abundant molecules within the pharmaceutical pipeline[3], the clinical benefit of new anticancer therapeutics is often modest at best. Better patient selection for clinical trials and within early stages of clinical cancer treatment, selected for molecular features of patients’ individual tumours, is required for better treatment outcomes. To address these issues, we have synthesized an imaging molecule capable of targeting integrin, a cellular adhesion protein often overexpressed in solid tumours. We have synthesized and characterised a novel biohybrid material, comprised of a known integrin α2β1 targeting peptide, conjugated to a novel organic semiconductor, based upon naphthalene diimide (NDI). The proposed use of the novel molecule is to self-assemble into a fluorescent nanogel around the periphery of solid, metastatic tumours, specifically those overexpressing integrin α2β1. Supramolecular assembly into a fluorescent gel has two primary effects, firstly, to provide critical diagnostic information. Secondly, the assembly of a gel provides a therapeutic effect itself, by preventing the secretion of signalling molecules from the solid tumour, which often drives further cancer development. Upon self-assembly of the nanogel, the emission spectra of the organic semiconductor may be altered and can be further modulated using known chemical design parameters to emit light within the near-infrared region, holding promise for emission visible through 2-3 cm of tissue. From a therapeutic viewpoint, our approach highlights the potential of targeting molecular features in tumours and in many other diseases by changing the conjugated targeting peptide. From the perspective of biohybrid material design, the potential to easily generate a whole library of different biohybrid materials based off similar organic semiconductors, conjugated to different targeting peptides, using well established solid phase peptide synthesis methodology, is an exciting prospect. Furthering our vision for future biohybrid material design, incorporation of increasingly complex biological material into organic semiconductor polymers holds great promise for the design of bionic skin, neuroprosthetics and wearable diagnostics. 1. Hanahan, D. and Robert A. Weinberg, Hallmarks of Cancer: The Next Generation. Cell, 2011. 144(5): p. 646-674. 2. Ferté, C., F. André, and J.-C. Soria, Molecular circuits of solid tumors: prognostic and predictive tools for bedside use. Nature Reviews Clinical Oncology, 2010. 7(7): p. 367-380. 3. Cottingham, M.D., C.A. Kalbaugh, and J.A. Fisher, Tracking the pharmaceutical pipeline: clinical trials and global disease burden. Clin Transl Sci, 2014. 7(4): p. 297-9.

Resume : Telomeres, the end parts of the chromosomes, contain repeated 6-nucleotide sequences (TTAGGG)n able to form so called G-quadruplex structures (G4) based on the stacks of guanine quartets. G4s are important cell regulatory elements whose detection is a challenging task. Their pi-electron systems can be studied by optics spectroscopy [1]. Specific optical properties of telomeric DNA (absorption, autofluorescence, autophosphorescence) and their environment-dependent changes allow using it as auto-luminescent sensing biomaterial. Here we have studied the spectral properties of telomere fragment d[AGGG(TTAGGG)3] (Tel22). Optical absorption (at 300K), fluorescence and phosphorescence (at 78K) of Tel22 samples folded into the G4 structure and unfolded by heating to various temperatures in the range 323-363K were investigated. The band at 295 nm associated with G-quadruplexes was observed in optical absorption of all samples. Only the band associated with G4 was observed in fluorescence spectra of the folded sample and the samples heated below 333K; no G4-associated fluorescence band was observed for samples heated above 343K. Phosphorescence of all samples was the emission of complex formed by A and T bases [1]. These effects are associated with thermal defolding of G4.

Resume : A well-known interest of using nanoparticles to deliver drugs is the controlled delivery of the contained therapeutic agent followed by internal or external stimuli. But these nanosystems are even more interesting if they combine several modalities. In our group, such combination has been used to obtain imaging and magnetic hyperthermia. The system consisted in an iron oxide nanoparticle encapsulated in a stellate mesoporous silica shell (IO@STMS). The shell was then functionalized with quantum dots and coated with Human Serum Albumin (HSA) [1]. The HSA was fixed through the isobutyramide (IBAM) strategy, demonstrated to allow the non-covalent but stable binding of several types of macromolecules to silica particles such as protein, nucleic acid, polysaccharide and polypeptide [2]. The aim of our work is to study the ability of this IO@STMS system to deliver interesting proteins for tissue regeneration. Thus, the stability of protein coating through the IBAM strategy will be studied as well as the thermo-induced release ability of such system. In addition, it is hypothesised that the combination of the IO@STMS with thermo-responsive (bio)polymers will allow the release of the protein through magnetic hyperthermia-induced conformational change, with the IBAM being used either to fix the new coating or to ensure protein adsorption. Several thermo-responsive polymers will then be studied, as well as several anchoring strategies on the particles. A particular attention will be given to understanding the interactions of proteins with the different particle surfaces, which is an important challenge of this work. [1] F. Perton, M. Tasso, G. A. Muñoz Medina, M. Ménard, C. Blanco-Andujar, E. Portiansky, M. B. Fernández van Raap, D. Bégin, F. Meyer, S. Begin-Colin, D. Mertz, Applied Materials Today 2019, 16, 301-314 [2] D. Mertz, P. Tan, Y. Wang, T. K. Goh, A. Blencowe, F. Caruso, Adv. Mater. 2011, 23, 5668-5673

Resume : Peptide-based materials have attracted a great deal of interest over the past few decades, due to their wide fields of application as basic components for highly biocompatible scaffolds for tissue engineering, efficient tools for protein and enzyme immobilization technologies, for affinity purification, biosensors, and protein chips. An important class of these compounds is represented by the amphiphilic peptides, easily constructed by binding together hydrophobic and hydrophilic amino acid residues, including the various possible structures linking charged heads to nonpolar tails, alternating positive/negative or polar/nonpolar repeat units. The self-organization process of these molecules is shown to be severely affected by the type of peptide and surface properties, including specifically the charge state at a given pH. The present work, therefore, is aimed to study the self-assembling behavior of a single tail Alanine-based peptide, expected to behave as a good surfactant, and a double tail Alanine-Lysine peptide, reproducing to the best the peculiar amphipathic structure of phospholipids. The two peptides, respectively characterized as single and double tail, at the interface between mica and an ultrathin solution film, exhibit strikingly different self-assembled structures, consisting in almost spherical unstructured aggregates in the first case, and micrometer-long fiber of nanometer width, in the second case. Atomic Force Microscopy (AFM) and Molecular Dynamic (MD) simulations have been used to analyze in great detail the processes responsible for the two different peptide arrangements, revealing that the strong ordering of double-tail peptides in long fiber is boosted by the peculiar role played by the surfaces, promoting the early orientation and organization of single peptide sequences in nanometer scale aggregates, and prompting the strong alignment processes of these aggregates at the mesoscopic scale. The results show the occurrence of a new collective mechanism involving the interplay between the reorganization at nanoscale of the unstructured peptide aggregates, previously formed in solution, and the specific driving role of surface properties prompting, among the others, the role of intramolecular and intermolecular hydrophobic interactions.

Resume : Reconstruction of critical bone size defect needs specific material to fill the lost and to promote neo-osteoformation. To be perfectly integrated, and able to favorize bone tissue regeneration at the site of implantation, such substitute must possess combined bio-properties to mediate an efficient dialogue with the surrounding cells. Specific sequences derived from bone sialoprotein and bone morphogenetic protein, - as RDG like and BMP-2 like peptides ? as emerged as interesting protagonists to act as proadhesive and osteocompetent partners able to induced an appropriate cell bone response. These peptidic sequences, inspired from natural protein, have attracted much attention, especially due to their high structure stability and their absence of immunogenicity. Commercial bioglass and natural bone purified by BIOBank, appears as interesting materials to serve as primary scaffold to design bone substitute. While the grafts generated from natural bone appear to be the best alternative to repair human bone defects thanks to their natural structure and properties; bioglass exhibited also interesting specificities, due to their capacity to release ions during their decomposition and generate locally apatite like matter. In this work, different peptides has been synthetized, characterized and grafted onto the two materials. Osteocompetent cells contacting responses are analyzed, following various parameters, as the synergistic effect of the co-adsorption of the two peptides.

Resume : Macrocycles with protein recognition properties have applications in controlled protein assembly for the development of new biohybrid materials. Water soluble, anionic calixarenes with affinity for positively charged residues (Lys, Arg) have been used to mediate protein oligomerization and direct the packing of protein frameworks. Crystal structures of cationic proteins in complex with sulfonato calix[n]arenes (sclxn) have highlighted the advantages of large, flexible calixarene hosts that can mould to protein surfaces. For example, sulfonato-calix[8]arene (sclx8) can encapsulate proteins and direct their assembly into porous frameworks. In this work, we turn our attention to a larger sclx8 derivative, p-benzyl sulfonate-calix[8]arene (b-sclx8). We anticipated that this “extended arm” calixarene, with 16 phenyl rings, would have increased capacity to mask/encapsulate the protein. Complex formation between b-sclx8 and cytochrome c (cyt c) was studied by NMR spectroscopy and X-ray crystallography, the latter revealing an unexpected biohybrid assembly of three components. A co-crystal structure of b-sclx8 and cyt c revealed a remarkable protein-bound pseudorotaxane comprising a stack of three b-sclx8 threaded by polyethylene glycol (PEG). The calixarene stacks present four grooves, each of which binds to one cyt c by accommodating the N-terminal α-helix. This unprecedented binding mode suggests new possibilities for supramolecular protein chemistry, including rotaxane formation with PEGylated proteins and alpha helical recognition by calixarenes.

Resume : Chemical sensors play important roles in various applications such as medical dagnotics, food safety and environmental monitoring. Field-effect-transistor (FET) based sensors are promising class of chemical sensors [1] and have gained significant attention, motivated by need of low cost biosensor capable of rapid and direct detection of target molecules without the requirement of expensive and time consuming labelling steps. In general SiO₂ have been employed for such kind of BioFETs. Silicon oxide-based BioFETs has several issues such as measurement drift, high leakage with thickness reduction and lack of repeatability as a result of low pH buffering capacity, susceptibility of gradual charge incorporation by ion diffusion when exposed to fluid and and low relative dielectric constant. The higher dielectric constant allows to achieving a large gate capacitance density which is directly related to channel conductance modulation i.e., bioFET sensitivity. Therefore low cost, high-k and novel BioFET sensor is required. In this work, we demonstrated highly sensitive DNA biosensor using bottom gate thin film transistor (TFT) with indium oxide channel and HfO₂ gate insulator prepared by chemical solution deposition (CSD). TFT were fabricated by the procedure previously reported [2]. At first, source solution of HfO₂ was spin coated on Pt/Ti/SiO₂/Si substrate followed by drying on a hot plate at 225 °C for 3 min. Crystalization of HfO₂ was done in O₂ atmosphere at 700 °C for 3 min using rapid thermal annealing (RTA). Next, the source solution of In₂O₃ was spin coated on HfO₂ and dried on a hot plate at 100 °C for 3 min. Then, the sample was annealed in O₂ atmosphere at 600 °C for 15 min. Finally, Pt source and drain electrodes are patterned by the lift-off process and the device area was isolated by wet etching. Next, BioTFT was fabricated by the same procedure as TFT. DNA was graft to TFT (Eurofin Genomics, Inc.) [AmC6] CCTATCGCTGCTACCGTGAA and DNA used for detection (Eurofin Genomics, Inc.) TTCACGGTAGCAGCGATAGG. At first, (3-Aminopropyl) triethoxysilane (APTES) 5 percent was mixed with 95 percent ethanol (EToH). Next, bio-solution was preparing with 25 percent glutaraldehyde solution (2 ml) diluted with DI water (18 ml) Using these solutions DNA mobilization process was carried out. Good transistor characteristics was obtained such as on/off ratio 1.6 x 10^6 , sub-threshold swing was estimated 470 mV/dec when Vg is swept from 15 to -15 V. Therefore, solution processed HfO₂ gate TFT was used for BioTFT. It was found that BioTFT can detect DNA. Shoulder is observed in transfer (Id-Vg) curve at 0.4 V which becomes more pronouced when the DNA concentration was increased. Moreover, SS value tends to degrade with increasing concentration of DNA. In conclusion, HfO₂ gated TFT were fabricated by solution process and normal n-type operation was demonstrated. Solution processed BioTFT were fabricated and DNA detection was confirmed with observed shoulder in transfer (Id-Vg) curve. [1] B.M. Lowe et al, Analyst, 142, 4173, 2017. [2] Mohit et al, Jpn. J. Appl. Phys., Jpn. J. Appl. Phys. 60 SBBM02

Resume : α-Chymotrypsin uses three cooperative amino acids constitutive of its catalytic triad, serine (Ser), histidine (His) and aspartate (Asp) to cleave the peptide bond through covalent catalysis. The mechanism differs from the uncatalyzed hydrolysis of the amide bond, a challenge when designing protease mimics. Despite the limited success of the DNA catalyzed hydrolysis, DNA is however an ideal scaffold due to its chemical stability, its ease of access by solid phase synthesis (SPS) and its perfectly controlled folding. Moreover, grafting additional organic functionalities would expand its catalytic repertoire. Using the convertible and/or functionalized phosphoramidite approaches we aim to mimic the active site of this serine protease with functionalized oligonucleotides (FuON) covalently modified at precise coordinates along their backbone with amino acids side chain-like residues (alcohol, imidazole or aspartate function for Ser, His or Asp respectively) (1). From a toolbox of twelve C5'-modifed thymidine phosphoramidites (varying both linkers and functions), families of FuON bearing up to three modifications could be obtained by SPS. They are then shaped into DNA secondary structures (3-way junction, bulges, hairpins) in an attempt to reproduce the active conformation of the triad. FuON combinations would then lead to heterogeneous libraries with skeletal and topological variety increasing the chances to screen for catalytic mimics. The first DNA catalysts libraries would be presented alongside the efforts to overcome the lack of a binding site. Their future insertion into 2D and 3D DNA nanostructures will also be discussed. (1) Addamiano, C.; Gerland, B.; Payrastre, C.; Escudier, J. M.; Molecules 2016, 21, 1082

Resume : Fighting microbial biofilms on biomaterials is usually addressed by incorporating antimicrobial agents. Nevertheless, as usual in the natural life, intrinsic properties of the material surface can be also a complementary approach. They may drastically reduce the quantity of adhered microorganisms, that are thus to be further treated by antimicrobial agents. Mechanical properties of material surfaces recently emerged as a possible way to impact biofilm formation. However, many questions have not been elucidated so far. We have especially studied whether hydrogel and non-hydrogel soft and stiff films may impact biofilm formation and microbial behavior in a similar or different way. The microbial mobility, adhered quantity, production of some organelles as well as the proteome of the adhered bacteria have been specifically investigated. The surface properties, especially mechanical ones, have been thoroughly characterized regarding the bulk and the surface viscoelasticity. The study has been conducted with yeast (Candida albicans) and bacteria species (Escherichia coli). Aside from the impact of softness versus stiffness properties on the amount, mobility and protein production of the adhered cells, it demonstrated significant differences of microbial behavior and biological response, even sometimes opposite, between hydrogels and non-hydrogels films. The proteomic results also implies that the mechanisms underlying the softness/stifness-related behaviors are significantly affected by the hydrogel/non-hydrogel properties of the surface. These results finally confirm the relevance of using some soft coatings to prevent biofilm formation on a material but also clarifies the risk to get opposite effects as desired. They also offer insights into the specific caracteristics to be preferred during new biomaterials development in order to achieve an intrinsic biofilm-adverse function.

Resume : Cisplatin (cis-Pt) is a complex of platinum which widely used as an anticancer drug. Transplatin (trans-Pt) has the same chemical formula, but different positions of atoms. Cisplatin connects to DNA in cancer cells and stops DNA replication, namely making cross-links between guanine bases. Transplatin is less reactive to DNA but also demonstrate cytotoxicity effect. In this work we make an attempt to connect the differences in the biological activity of mentioned structures with the data obtained by optical spectroscopy methods. The UV-vis spectra as well as fluorescence and phosphorescence spectra of water solutions of cis-Pt and trans-Pt were investigated at temperatures 300 and 77 K. Quantum chemical calculations were used for correct interpretation of obtained results. We also characterized these compounds using such powerful method as Raman spectroscopy.

Resume : Peptoids represent an emergent class of synthetic polymers differing from peptides by the side chain position on the nitrogen atom instead the alpha carbon to amide moiety [1]. Peptoids can adopt secondary structures in solution such as helix. However, unlike peptides and proteins [2-3], no data concerning the gas phase structure of peptoid ions is to date present in the literature. In our laboratory, we combine ion mobility mass spectrometry (IMMS) and computational chemistry to provide data on the 3D structures adopted by gaseous ions. Nevertheless, the ionization/desolvation processes related to the use of MS can generate huge structural modifications. Thus, the conservation of helical structure during the transfer from the solution to the gas phase represents a great challenge since most of the time, a charge solvation effect is observed during the transfer to the gas phase. Currently, a specific attention is given to design original peptoids with a localised charge to avoid possible charge solvation effect and potentially adopt an helical structure in gas phase. Its backbone possesses (S)-phenylethyl side chains (Nspe), a bulky chiral group known to form helix in solution [4], and a (S)-N-(1-carboxy-2-phenylethyle) (Nspc) at C terminus. This sequence could optimize the interaction between the negative charge located on the C terminus and the helix macrodipole. Moreover, the influence of Nspc position and acetylation are investigated. [1] Zuckermann et al., J. Am. Chem. Soc., 1992, 114, 10646 [2] Micah T.D et al., Analytical Chemistry 2017, 89, 9, 5107-5114 [3] Kim D.et al., J. Am. Chem. Soc. 2017, 139, 2981-2988 [4] Wu et al., J. Am. Chem. Soc., 2003, 125, 13525–13530

Resume : Current medical and health diagnostic technology rely on mature biosensor technology that can provide a rapid and accurate diagnosis. 1 However, traditional sensors produced from rigid materials are inflexible and hard-to-wear2, which is inconvenient for diagnostics at the point-of-care (PoC).3 Field effect transistors (FET) with low detection limitation, which achieved based on its high sensitivity through transconductance effect, could be built as a flexible fibre device as a basement for e-textile and wearable PoC devices.4 Graphene and two-dimensional materials are used due to their, large surface area, chemical stability, and excellent electrical conductivity.5 In this work we report an FET avidin-biotin-biosensor on fibre produced in a core-shell architecture using reduced graphene oxide (rGO) and hexagonal boron nitride (h-BN). The rGO was synthesised using the modified Hummer’s method, at a concentration of 10 mg mL -1 in water. This dispersion was spun into fibres using wet spinning, exhibiting a conductivity of ~ 8,000 S m-1. The rGO fibre used as the core is then further dip-coated with h-BN as an insulating layer, followed by another rGO layer as the fibre FET channel. This structure represents a key enabling step for wearable fibre-based biosensors that can be integrated into textile platforms, paving the way to truly wearable diagnostics. 1 N. Mandal, V. Pakira, N. Samanta, N. Das, S. Chakraborty, B. Pramanick and C. RoyChaudhuri, Talanta, 2021, 222, 121581. 2 C. C. Vu, S. J. Kim and J. Kim, Science and Technology of Advanced Materials, 2021, 22, 26–36. 3 D. Quesada-González and A. Merkoçi, Chemical Society Reviews, 2018, 47, 4697–4709. 4 S. Hong, M. Wu, Y. Hong, Y. Jeong, G. Jung, W. Shin, J. Park, D. Kim, D. Jang and J. H. Lee, Sensors and Actuators, B: Chemical, 2021, 330, 129240. 5 F. Torrisi and T. Carey, Nano Today, 2018, 23, 73–96.

Resume : Food spoilage produces two major impacts: in health due to food poisoning and in economics due to food waste. This is especially true for meat products, which provide a nutrient-rich environment for the development of bacteria. Uncontrolled microbial growth renders the meats unsuitable for human consumption thus a sensor that can evaluate the level of microbiota development is needed for signaling the early onset of spoilage and prolonging the shelf life of the products. Histamine is a biogenic amine that can be electrochemically assessed using metallo-porphyrins (Co and Mn) immobilized onto carbon electrodes. In this study, we present a novel type of electrochemical sensor which uses two working electrodes onto which the two metalloporphyrins have been immobilized by dropcasting. This way we can simultaneous evaluate the presence and the amount of histamine in meat samples. As a reaction mediator we used trichloroacetic acid and the reaction was modelled using HyperChem® software. Keywords: histamine detection, porphyrin functionalization, double working electrode, electrochemistry. Acknowledgements: 87PD/2020, 393PED/2020, 18/N/2019, 19PFE/17.10.2018

Resume : Nature has the amazing ability to achieve a perfect control over the monomer sequence in biological macromolecules. This microstructural precision leads to sophisticated structures with remarkable functions such as catalysis, molecular recognition, and information storage. Inspired by the precision of biological macromolecules, the design of synthetic sequence-defined polymers constitutes an emerging topic to generate materials with next-generation performances. Despite considerable progress on the control over the primary structure, the controlled folding and assembly of synthetic polymers into predetermined three-dimensional shapes have not been achieved so far. Here we use computational chemistry approaches to decipher the structure and dynamics of sequence-defined oligomeric chains used for supported catalysis. These oligomers incorporate structuring groups and three functional moieties for the selective oxidation of alcohols. The oligomeric chains under study differ by the monomer sequence and the number of molecular spacers between the catalytic moieties. In combination with the experimental catalytic activity, our computational study brings insights into structure-activity relationships for targeted applications in catalysis.

Resume : In the last years, organic electronics-based immunosensors, such as electrolyte-gated organic transistors (EGOTs), have emerged as promising alternative strategies for the ultrasensitive and label-free detection of biological analytes. Their intrinsic characteristics, such as high amplification, low cost, flexibility, and biocompatibility, make them suitable for point of care testing. EGOTs are commonly classified as Organic Electrochemical Transistors (OECTs) and Electrolyte-Gated Organic Field-Effect Transistors (EGOFETs), depending on the permeability of the active layer to the electrolyte ions. Both EGOFETs and OECTs are three-electrode devices, where the current flowing within the organic (semi)conductor bridging source and drain electrodes is controlled by the potential applied to the gate electrode (1). Multiple sclerosis (MS) is a chronic and inflammatory disorder of the central nervous system characterized by progressive neurodegeneration (2). The accurate detection and quantification of biomarkers of neural degeneration is an urgent need to correctly assess the diagnosis of MS and the management of the disease. Therefore, highly sensitive methods, able to detect very low concentrations of the biomarker and discriminate MS patients from healthy individuals are required. Here, we propose a novel EGOT-based biosensor for the detection of neurofilament light chain (NF-L), a candidate MS biomarker. In the proposed architecture, the specific recognition of the biomarker is ensured by immobilizing anti-NF-L antibodies on the gate electrode surface, with a controlled and uniform orientation. A concentration-dependent change in the output current was observed as a consequence of the binding events occurring at the gate surface, between the antibody and its corresponding target analyte. Additionally, different electrical parameters, including transconductance and threshold voltage, were monitored during the experiments. Finally, in order to validate the selectivity of the device and the absence of a non-specific response, a number of control experiments were performed. Our biosensor proved to be highly selective for the detection of NF-L in a wide dynamic range of concentrations, even in complex medium, indicating that it could be safely implemented at the point of care for the real-time monitoring of the disease. (1) L. Torsi, M. Magliulo, K. Manoli, G. Palazzo, Chem. Soc. Rev. 2013, 42, 8612. (2) A. Compston, A. Coles, Lancet 2008, 372, 1502.

Resume : Organic biosensors combine the potentialities of electronic sensors, such as small dimensions, response speed and system integration, with those of organic semiconductors, being the low cost, flexibility, and biocompatibility. Among them, organic transistor biosensors have shown to be specially interesting for health care application and food monitoring. In this respect, Electrolyte Gated Organic Transistors (EGOTs) are rapidly emerging as one of the architectures of choice for label-free biosensing. The main feature of EGOTs is that they operate in an aqueous environment, using an electrolyte containing the analyte as dielectric between the gate electrode and the semiconductive organic channel. EGOTs are commonly subdivided into two families: Organic Electrochemical Transistors (OECTs) and Electrolyte Gated Organic Field Effect Transistors (EGOFETs). The former usually exploiting a polymeric organic semiconductor whose conductivity can be modulated through redox reactions (faradaic regime) and/or through the permeation of ions present in the electrolyte upon application of gate voltage (not faradaic or capacitive regime). On the other hand, EGOFETs use less permeable semiconductor films based on small molecules and just work in the capacitive regime. One of the unsolved questions that is stirring great interest in the organic bioelectronics scientific community is what configuration (either EGOFET or OECT) is to be preferred when attempting to develop a potentiometric (i.e. non faradaic) biosensor. We contribute to this debate by testing and comparing Interleukin-6 (IL-6) biosensors based on OECT and EGOFET configuration. IL-6 is a small homodimeric protein (19-26 kDa), which belongs to the family of cytokines. IL-6 is involved in the induction of proinflammatory proteins, hematopoiesis and immune cells differentiation. At physiological levels, IL-6 can be detected in circulation at very low concentrations (1pg/mL), and it can expand up to a thousand-fold during infection or any other inflammatory triggering event. Consequently, it is widely considered a biomarker of diseases associated to inflammation, such as cancer, obesity, arthritis, among others. It is worth to mention that during the current COVID-19 pandemic situation, IL-6 has been investigated as a candidate biomarker, as part of the “cytokine storm” released during the infection. We successfully demonstrated detection of IL-6 in concentration levels that span both the physiological and pathological ranges with both OECT- and EGOFET-based biosensors. In order to test the selectivity of the biosensors toward the analyte of interest, control experiments with potentially interfering cytokines were performed, showing significantly lower response and providing therefore evidence of the selectivity of the device, the response of which might therefore be safely ascribed to specific recognition between immobilized biorecognition elements and the corresponding analyte.

Resume : Organic biosensors combine the potentialities of electronic sensors, such as small dimensions, response speed and system integration, with those of organic semiconductors, being the low cost, flexibility, and biocompatibility. Among them, organic transistor biosensors have shown to be specially interesting for health care application and food monitoring. In this respect, Electrolyte Gated Organic Transistors (EGOTs) are rapidly emerging as one of the architectures of choice for label-free biosensing. The main feature of EGOTs is that they operate in an aqueous environment, using an electrolyte containing the analyte as dielectric between the gate electrode and the semiconductive organic channel. EGOTs are commonly subdivided into two families: Organic Electrochemical Transistors (OECTs) and Electrolyte Gated Organic Field Effect Transistors (EGOFETs). The former usually exploiting a polymeric organic semiconductor whose conductivity can be modulated through redox reactions (faradaic regime) and/or through the permeation of ions present in the electrolyte upon application of gate voltage (not faradaic or capacitive regime). On the other hand, EGOFETs use less permeable semiconductor films based on small molecules and just work in the capacitive regime. One of the unsolved questions that is stirring great interest in the organic bioelectronics scientific community is what configuration (either EGOFET or OECT) is to be preferred when attempting to develop a potentiometric (i.e. non faradaic) biosensor. We contribute to this debate by testing and comparing Interleukin-6 (IL-6) biosensors based on OECT and EGOFET configuration. IL-6 is a small homodimeric protein (19-26 kDa), which belongs to the family of cytokines. IL-6 is involved in the induction of proinflammatory proteins, hematopoiesis and immune cells differentiation. At physiological levels, IL-6 can be detected in circulation at very low concentrations (1 pg/mL), and it can expand up to a thousand-fold during infection or any other inflammatory triggering event. Consequently, it is widely considered a biomarker of diseases associated to inflammation, such as cancer, obesity, arthritis, among others. It is worth to mention that during the current COVID-19 pandemic situation, IL-6 has been investigated as a candidate biomarker, as part of the “cytokine storm” released during the infection. We successfully demonstrated detection of IL-6 in concentration levels that span both the physiological and pathological ranges with both OECT- and EGOFET-based biosensors. In order to test the selectivity of the biosensors toward the analyte of interest, control experiments with potentially interfering cytokines were performed, showing significantly lower response and providing therefore evidence of the selectivity of the device, the response of which might therefore be safely ascribed to specific recognition between immobilized biorecognition elements and the corresponding analyte.

Resume : Research has made drastic progresses with cell culture, leading to some improvement in the understanding of cellular and molecular mechanisms. Nevertheless, two-dimensional (2D) in vitro studies may reflect results that differ from those in vivo because of the flattened way cells grow on plate. Such differences in cell morphology can account for some variabilities between in vitro and in vivo results. Furthermore, in vivo studies are strictly regulated, hard and long to lead, with also ethical considerations. New methods based on three-dimensional (3D) cell culture using supramolecular gel matrix, where cells could grow in a proper spatial organization, can be implemented to overcome these limitations, forming a bridge between in vitro and in vivo. In this study, we investigate a class of biomaterials consisting of supramolecular assembly of amphiphilic glyco-nucleolipid-based gelators (GNBA). This molecular self-assembly forms a hydrogel used as a scaffold for 3D cell culture. Rheology characterization and electron microscopy experiments of these hydrogels show fibrillar architecture and viscoelastic properties in cell culture media mimicking the extracellular matrix with enough stiffness to support cell viability. Their kinetic and thermal features (i.e. thermal reversibility of the gelation and high gel-sol transition temperature) permit easy handling and stability for culture incubation. As gelators concentration and the nature of some moieties of the molecular structure are highly influencing gels properties, these could be tuned depending on the purpose. Our results of cells incorporated into these hydrogels show small-sized spheroids growing for at least 1 month, supporting a proof-of-concept of nucleolipid-based hydrogel matrix. Next steps consist of refining a protocol of 3D cell culturing in order to grow multicellular tumor spheroids for toxicity assays.

Resume : The study of biological process from the chemical perspective allows a better understanding of Life, as well as the molecular intervention in both normal and pathological situations. However, biomolecules are not isolated entities since their function depend on their mutual interactions, thus playing a role within complex molecular networks and systems. The study of the interaction and communication between molecules represents the core of the so-called Supramolecular Chemistry, thus being fundamental to tackle biological process at the molecular level. In this lecture, I will discuss the close relationship between Supramolecular Chemistry and Chemical Biology, illustrating the idea with key recent examples from our own research group. Thus, selected cases based on the design of specific receptors able to recognize molecules or ions with biological relevance will be presented. Moreover, the dynamic covalent chemistry approach will be also explained with recent examples from our research group. These molecular recognition processes can be traduced into interesting biological activities. Overall, this approach has led to the development of inhibitors of commercial drugs, diagnostic tools for some diseases or cytotoxic molecules against cancer cells. Acknowledgements: Financial Support from the Ministry of Science, Innovation and Universities (RTI2018-096182-B-I00, MCIU/AEI/FEDER, EU) and AGAUR (2017 SGR 208), are gratefully acknowledged. I also express my deepest gratitude to all the co-workers who made possible this research.

Resume : Peptide secondary structures can be harnessed to design monomers capable of self-assembling into nano-scaled supramolecular structures in aqueous media.[1,2] Decorating the surface with immunogenic molecular patterns results in pathogen-mimicking entities and potential vaccine candidates.[3] In the context of antitumor vaccines, the challenge is to overcome self-tolerance mechanisms to enforce an immune response against endogenous, tumor-associated glycopeptide motifs.[4] To this end, a co-stimulation of B cells with Th cells is mandatory, which we aim to achieve using a co-presentation of different epitopes and immunostimulating agents at the surface of multicomponent supramolecular polymers. Mucin 1 (MUC1) is well-known for undergoing alterations in O-glycosylation during tumorigenesis, and is thus an excellent tumor-associated target structure for immunotherapy. In this contribution I discuss the use a fully synthetic glycopeptide from the MUC1 tandem repeat sequence, which consists of 22 amino acids bearing the Tn and 2,3-Sialyl T tumor associated antigens. As T cell epitope we chose a small fragment from highly immunogenic tetanus toxin (p30). Additionally, an imidazoquinoline as potent TLR7/8 agonist,[5] was synthesized. These epitopes were conjugated to supramolecular monomers and mixed in aqueous solution to yield a polymeric vaccine formulation. The vaccines were administered intraperitoneally to C57BL/6 mice and the antisera were collected after three further boosts. High antibody titers of the IgG type were observed in all mice. Furthermore, FACS analysis confirmed the high binding affinity of the generated antibodies to T47D tumor cells. These results support the potential of this modular supramolecular platform approach for the development of antitumor vaccines. References: [1] Angew. Chem. Int. Ed. 2018, 57, 11349; [2] Chem. Rev. 2016, 116, 2414; [3] ChemBioChem 2018, 19, 912; [4] ChemBioChem 2018, 19, 1142; [5] J. Med. Chem. 2010, 53, 4450.

Resume : Triarylamine molecules have been extensively used over the past 60 years for their conducting and optical properties. However, the supramolecular polymerization and self-assembling properties of these molecules remained unknown until very recently. In 2010, for the first time, our group reported that chemically designed triarylamine molecules incorporating amide functions at their periphery can precisely pack into columnar supramolecular polymers with a collinear arrangement of the central nitrogen centers. We subsequently demonstrated the versatility of this triarylamine scaffold in terms of self-assembling properties leading to various soft hierarchical structures such as nanofibers, nanoribbons, and nanospheres, as well as to crystalline supramolecular frameworks. In addition, we further demonstrated the intriguing electronic, magnetic, and optical properties of these supramolecular polymers, as well as their ability to be incorporated in nano- or micrometric devices by original bottom-up approaches (Acc. Chem. Res. 2019, 52, 975-983). We will show that the triarylamine core can be decorated with various biomolecules (peptide, nucleobases), which provide a second level of organization in the resulting self-assembled structures. We will also highlight that these supramolecular polymers can find applications in bioelectronics and as biomimetic materials.

Resume : The study of complex molecular networks and supramolecular assemblies is a clear objective of the field so-called systems chemistry, which is expected to have a great impact in the area of origins-of-life research and as biohybrid materials in materials science. We are starting to explore this field from both a theoretical [1,2] and an experimental point of view. With regards to the origins of life, a pertinent question is whether artificial cells could be constructed from non-natural components. In order to provide clues about this question, we have started research lines on nucleic acid hybrids, replicating nucleopeptide networks [3] and nucleolipid compartments [4]. The study and combination of these components is an interesting approach because it allows exploring some properties of life without the restrictions of the historical pathway that Darwinian evolution took. Concerning the approach to biohybrid materials, we focus our work on supramolecular approaches toward biohybrids for biomedical light management [5], which combine different photoactive molecules with peptide, protein and nucleic acid nanostructures. For example, we have recently studied the electrostatic co-crystallization of a cationic porphyrinoid and negatively charged tobacco mosaic virus (TMV), together with the capacity of the resulting crystals to photogenerate reactive oxygen species [6]. In a different approach, electrostatically assembled zinc Pc-DNA origami complexes have been demonstrated [7]. In this presentation we will shortly discuss some of these research lines. References: 1) A. de la Escosura, ?The Informational Substrate of Chemical Evolution: Implications for Abiogenesis?. Life 2019, 9, 66. 2) K. Ruiz-Mirazo, C. Briones, A. de la Escosura, ?Chemical Roots of Biological Evolution: The Origins of Life as a Process of Development of Autonomous Functional Systems?. Open Biol. 2017, 7, 170050. 3) A. de la Escosura, G. Ashkenasy, et al., ?Primitive Selection of the Fittest Emerging Through Functional Synergy in Nucleopeptide Networks?. Proceed, Natl. Acad. Sci. USA, in press. 4) S. Morales-Reina, C. Giri, M. Leclercq, S. Vela-Gallego, I. de la Torre, J. R. Caston, M. Surin, A. de la Escosura, ?Programmed Recognition between Complementary Dinucleolipids to Control the Self-Assembly of Lipidic Amphiphilles?. Chem. Eur J. 2019, 26, 1082-1090. 5) V. Almeida-Marrero, E. van de Winckle, E. Anaya-Plaza, T. Torres, A. de la Escosura, ?Porphyrinoid Biohybrid Materials as an Emergent Toolbox for Biomedical Light Management?. Chem. Soc. Rev. 2018, 47, 7369. 6) E. Anaya-Plaza, A. Aljarilla, G. Beaune, Nonappa, J. V. I. Timonen, A. de la Escosura, T. Torres, M. Kostiainen, "Phthalocyanine?Virus Nanofibers as Heterogeneous Catalysts for Continuous?Flow Photo?Oxidation Processes", Adv. Mater. 2019, 31, 1902582. 7) A. Shaukat, S. Julin, V. Linko, E. Anaya-Plaza, T. Torres, A. de la Escosura, M. Kostiainen, ?Phthalocyanine-DNA Origami Complexes with Enhanced Stability and Optical Properties?. Chem. Commun. 2020, 56, 7341-7344.

Resume : Context and objective Aptamers are synthetic sequences that exhibit a high and specific affinity for a determined target, i.e. a small molecule, cell receptor, whole cell or even a tissue. In drug delivery, aptamers have mainly been used as targeting ligands to drive the drug to the target cell. In this work, we consider drug-binding aptamers as specific drug carriers, thanks to their high affinity for their cognate drug. Supramolecular assemblies of quinine-binding aptamers were designed to carry quinine into the Red Blood Cells infected by Plasmodium falciparum, in order to improve malaria treatment. Since high molecular weight is required to prevent from renal filtration and improve blood circulation time, the goal of this project is to design a supramolecular assembly of DNA aptamers, called nanotrain, as a drug delivery system. Methods Aptamer sequence was appended with hybridation sequences to trigger the nanotrain assembly. Two strategies were investigated: first, a continuous hybridization using two complementary sequences that associate one after the other in a polymer-like structure and secondly, the controlled association of up to 4 specific sequences for each aptamer. In each case, the sequences were designed, the thermal stability and the affinity for quinine were investigated by UV and fluorescence, respectively. The supramolecular assembly was checked by PAGE electrophoresis. Results The sequential method led to the controlled assembly of 2, 3, and 4 aptamers in a selective and controlled fashion, as observed by PAGE electrophoresis. The polymer-like structure also showed supramolecular assembly of up to 3 aptamers. The supramolecular assemblies could be observed in TEM. The binding affinity of the aptamers for quinine was maintained in the supramolecular assembly, demonstrating its loading capacity. Future work focuses on the conjugation of an aptamer targeting malaria-infected Red Blood Cells, serum stability and drug release in biological conditions.

Resume : Molecular biodynamers are synthetic biopolymers polymerized by dynamic covalent bonds.[1] The dynamic covalent bond is a reversible covalent bond at specific pH or temperature. Therefore, the polymerization of the molecular biodynamer is reversible, and the monomer components are dynamically exchangeable under such conditions. In previous studies, we showed that a protein-like biodynamer formed by acylhydrazone/imine bonds between a hexaethylene glycol conjugated carbazole dicarboxaldehyde and a lysine hydrazide has the following properties, 1) dynamic polymerization in a mildly acidic aqueous medium, 2) monomer exchanges at low pH and 3) formation of 10 nm nanorods after the polymerization.[1] This research has further examined the morphology changes of the biodynamer in its nanorod formation and pH-dependent property changes using light scatterings (SLS and DLS) and small-angle neutron scattering (SANS). Furthermore, we demonstrate its application in the development of novel transfection agents for efficient vaccination. As a result, we observed morphological changes of the biodynamer (from 250 nm spherical micelles to 10 nm nanorods) by the polymerization using LSs, transmission electron microscopy (TEM), and SANS. We have also examined fluorescence emission shifts, from emission peak top= 470 nm to 535 nm upon increasing pH from 3 to 13, due to a protonation on the carbazoles in the polymer backbone. In addition to the fluorescence shifts, the pH-dependent protonation on the backbone also affects the size of the nanorods. While the pH increases from 3 to 13, the size of the nanorods decreases by up to 37%.[2] We formulated a nanocomplex, dynaplex, using polylysine-derived biodynamers and mRNA to demonstrate it as a pH-responsive nucleotide delivery material. The dynaplexes have shown excellent biocompatibility and 98% of transfection efficiency, outperforming conventional transfection agents in human cell lines (A549, Caco-2). Moreover, their transfection efficiency and cell-interaction were adjustable by changing biodynamer composition.[3] We expect that these results support broadening the application of the molecular biodynamers as stimuli-responsive materials, drug delivery carriers, and biosensors. [1] Liu Y, et. al., Adv. Funct. Mater. 2016, 26 (34), 6297-6305 [2] Lee, S. et al., Mater. Chem. Front., 2020, 4, 905-909 [3] Lee, S. et al., 2021, in submission

Resume : Foldamers constitute a class of oligomers that can fold into conformationally ordered architectures. Such compact conformations show structural and functional similarities with biopolymers, mimicking their highly ordered structures and functions. A wide variety of building blocks (e.g. peptides, ureas,…) have been reported to form such structures through weak intramolecular interactions and have displayed remarkable properties in the context of chiral materials, molecular recognition or catalysis, for instance. While important efforts have been devoted to the study of these dynamic structures and their stimuli-controllable conformational changes, pi-functional helical foldamers remain scarce in the literature. On this ground, we have recently depicted the synthesis of photoactive and electro-switchable foldamers endowed with redox units, designed to afford dynamic, and hence, stimuli-responsive architectures.[1-3] This communication will focus on our most recent results, which deal with the redox-controlled hybridization of foldamers into double helices and their anion recognition properties at the solid-liquid interface. [1] F. Aparicio, L. Faour, M. Allain, D. Canevet, M. Sallé, Chem. Commun., 2017, 53, 12028–12031. [2] L. Faour, C. Adam, C. Gautier, S. Goeb, M. Allain, E. Levillain, D. Canevet, M. Sallé. Chem. Commun., 2019, 55, 5743–5746. [3] C. Adam, L. Faour, V. Bonnin, T. Breton, E. Levillain, M. Sallé, C. Gautier, D. Canevet, Chem. Commun., 2019, 55, 8426–8429.

Resume : Extending constitutional dynamic chemistry (CDC) to polymer and material science, constitutional dynamic frameworks presented in this lecture are adaptive systems that respond to internal and external factors. Through the feedback induced self-assembly/reorganization mechanism, the “fittest” architecture can be selected and amplified. Various examples of such dynamic materials with intrinsic adaptive properties at both molecular and supramolecular levels will been discussed with their interesting applications : Enzyme inhibition and activation, DNA transfection, antibacterial activity, etc. References Y. Zhang, M. Barboiu, Constitutional Dynamic Materials. Toward Natural Selection of Function, Chem. Rev. 2016, 116, 809-834. Y. Zhang, Y.H, Li, C.Y. Su, M. Barboiu, Dynameric frameworks with aggregation-induced emission (AIE) for selective detection of ATP, ChemPlusChem, 2018, 83, 506-513. Y. Zhang, E. Petit, M. Barboiu, Multivalent Dendrimers and their Differential Recognition of Short Single-Stranded DNAs of Various Length and Sequence, ChemPlusChem, 2018, 83, 354 –360. Y. Zhang, C.T. Supuran, M. Barboiu, Exponential activation of Carbonic Anhydrase by encapsulation in dynameric host-matrices with chiral discrimination, Chem. Eur. J. 2018, 24, 715-720. L. Marin, D. Ailincai, M. Calin, D. Stan, C. A.Constantinescu, L. Ursu, F. Doroftei, M. Pinteala, B.C. Simionescu, M. Barboiu Dynameric Frameworks for DNA transfection. ACS Biomater. Sci. Eng., 2016, 2, 104-111. L. Clima, D. Peptanariu, M. Pinteala, A. Salic, M. Barboiu, DyNAvectors: dynamic constitutional vectors for adaptive DNA transfection, Chem. Commun., 2015, 51, 17259-17531. L. Marin, B. Simionescu, M. Barboiu, Imino-Chitosan Biodynamers Chem. Commun., 2012, 48, 8778-8780.

Resume : Controlled protein assembly remains a major obstacle to the development of nanoscale devices and biomaterials. We and others have shown that macrocycles are useful building blocks to direct protein assembly.(1-6) For example, the “rigid doughnut” cucurbit[7]uril mediates sheet- and cage-like assemblies of the model lectin RSL, via complexation of dimethylated lysines.(4,6) X-ray data reveal cucurbit[7]uril clusters in the crystal structures. New strategies that combine cucurbituril clusters with other features such as metal binding sites will be presented. References 1) van Dun S, Ottmann C, Milroy LG, Brunsveld L. J. Am. Chem. Soc. 2017, 139, 13960. 2) Kuan SL. Bergamini FRG, Weil T. Chem. Soc. Rev. 2018, 47, 9069. 3) Rennie ML, Fox GC, Pérez J, Crowley PB. Angew. Chem. Int. Ed. 2018, 57, 13764. 4) Guagnini F, Antonik PM, Rennie ML, O'Byrne P, Khan AR, Pinalli R, Dalcanale E, Crowley PB. Angew. Chem. Int. Ed. 2018, 57, 7126. 5) Engilberge S, Rennie ML, Dumont E, Crowley PB. ACS Nano 2019, 13, 10343. 6) Guagnini F, Engilberge S, Ramberg KO, Pérez J, Crowley PB. Chem. Commun. 2020, 56, 360.

Resume : Designing biopolymer-coated nanoparticles has become central in the field of theranostic nanoparticles. Previously, we pioneered an original approach using isobutyramide (IBAM) grafts to assemble non-covalently, a range of biofunctional protein-based hollow capsules for drug delivery or enzymatic catalysis without the need of an additional cross-linking[1-2]. In recent works, we translated this innovative IBAM-protein nanocoating approach for the design of novel hybrid protein coated nanoplatforms made of magnetic or carbon cores covered with a mesoporous silica shell. Hence, protein-coated MS shells were recently deposited at the surface of iron oxide NPs for bimodal fluorescence /MRI imaging and magnetic hyperthermia [3]. The approach was also translated for the design of novel protein coated carbon nanotubes [4] [1] D. Mertz, P. Tan, Y. Wang, T. K. Goh, A. Blencowe, F. Caruso, Adv. Mater. 2011, 23, 5668-5673. [2] D. Mertz, J. Cui, Y. Yan, G. Devlin, C. Chaubaroux, A. Dochter, R. Alles, P. Lavalle, J. C. Voegel, A. Blencowe, P. Auffinger, F. Caruso, ACS Nano 2012, 6, 7584-7594. [3] Perton, F., Tasso, M.; Muñoz, G.A; Ménard, M.; Portiansky, E.; Blanco-Andujar, C.; Fernández van Raap, M.B.; Bégin, D.; Meyer, F.; Bégin-Colin, S; Mertz, D.. Appl. Mater. Today, 2019,16, 301-314. [4] V. Fiegel, S. Harlepp, S. Begin-Colin, D. Begin, D. Mertz, Chem. Eur. J. 2018, 24, 4662.

Resume : Biohybrid nanostructures involving metallic elements essential to life have been observed in a variety of organisms. For instance, magnetic assemblies, composed of iron oxides, are produced by organisms ranging from bacteria through higher vertebrates for magnetoreception. The biosynthesis of nanostructures involving non-essential elements is more scarce. Recently, we have been interested in the long-term intracellular fate of gold nanoparticles which are increasingly used in biomedicine. Prior to our study, it was generally admitted that the inertness of gold particles prevents their degradation. Nevertheless, we studied in vitro their fate in primary fibroblasts during 6 months by combining electron microscopy and transcriptomics study. In this way, we revealed an unexpected 2-step process of biotransformation.[1] First, we evidence the intracellular degradation of GNPs with a size-dependent dynamic. This degradation is induced by reactive oxygen species, generated by membrane protein assemblies, that oxidized GNPs. Second, we show that the released ionic gold undergoes a biomineralization process and ends up in well-defined structures consisting of 2.5 nm crystalline particles self-assembled into nanoleaves. Reviewing of the literature dedicated to therapeutic gold salts evidences that similar structures, called aurosomes, have previously been described in vivo in different species. It supports the original idea that ionic and crystallized gold have a common intracellular fate. The morphological features of aurosomes and the transcriptomics results designate metallothioneins as credible candidates to capture gold and form the ubiquitous crystalline cluster.

Resume : Over the past four decades, electronic circular dichroism (ECD) has been widely used to empirically investigate bio-molecular systems due to the fact that it is extremely sensitive to conformational changes in both solids and liquids. For instance, it is used to characterize the secondary structures of proteins,(1) to follow the induction of chirality of an achiral probe in a chiral environment,(2) and to elucidate the helical structure of DNA and its variations.(3) In addition to empirical investigations, theory has been used to rationalize experimental results with the intention of reaching a predictive power. For small systems, the simulation of ECD responses is a task well suited for standard time-dependent density functional theory (TD-DFT).(4) However, the size of the systems remains a bottleneck despite the progress of supercomputers, and theoreticians have had to develop original approaches to be able to address larger systems with reasonable accuracy. We will illustrate our approach combining MD simulations and QM/MM calculations on three case studies: - The calculation of the ECD spectra of perfect double-helical conformation of DNA of various sequences and show how the ECD signal can be affected when the DNA sequence is wrapped around the histone core.(5) This was achieved by using a base pair approach where the total ECD signal was estimated as the sum of the base pair dimers contribution.(2) - The case of DAPI (4’,6-diamidino-2-phenylindole), a popular DNA stain due to the fluorescence enhancement upon minor-groove binding in AT-rich regions of double stranded DNA. Its binding mode also results in a strong induced circular dichroism (ICD). We have provided an explanation of the origin of this ICD based on a combination of exciton coupling and QM/MM simulations and showed that the ICD signal was a complex interplay between exciton coupling, chiral imprint, and charge transfer.(6) We will show how all these contributions can also be considered simultaneously within a single QM calculation. - The human telomeric sequences, made of repeats of the d(TTAGGG) fragment is known to form G-quadruplexes at the ends of chromosomes and constitute a relevant biomolecular target in cancer research. In the last two decades, metal complexes such as ruthenium polyazaaromatic complexes have been used as DNA binders. In particular, a few are attractive as “light switches” because of their strong luminescence enhancement upon DNA binding.(7) The ECD response of this system is a complex overlap of contribution of the G-quadruplex, ICD of the ligands upon binding, and charge transfer. We will demonstrate how our approach allow a simultaneous calculation of the ECD signal contributions stemming from the G-quadruplex as well as from the ICD of the complex attached to it. --- (1) N. J. Greenfield, Nat Protoc., 2006, 1, 2876 (2) Di Meo, F. et al. J. Phys Chem. Lett., 2015, 6, 355 (3) Kypr, J. et al., Nucleic Acids Res. 2009, 37, 1713 (4) Autschbach, J. et al. Top. Curr. Chem. 2011, 298, 1; Crawford, D. C. et al. Theor. Chem. Acc. 2006, 115, 227 (5) Norman, P.; et al.  Phys. Chem. Chem. Phys., 2015, 17, 21866 (6) Holmgaard List, N. et al. JACS, 2017, 139, 14947 (7) Rubio-Magnieto, J. et al. Chem. Eur. J. 2018, 24, 15577

Resume : tba

Resume : Water-soluble pi-conjugated polymers are increasingly considered in supramolecular approaches for DNA biosensing. However, the conformational rearrangement and supramolecular organization upon interaction with DNA remains overlooked, which limits a rational design of such detection tools. To understand the binding between DNA and cationic polythiophene (CPT), which are utilized in DNA detection experiments, we performed molecular modeling simulations of their supramolecular assembly. By comparing several simulations, we show a multiplicity of binding modes. The simulated Circular Dichroism (CD) spectra show that the origin of the induced CD signals are arising from short helical segments of neighbouring thiophene units in syn (cisoid conformations). At the macromolecular scale, we inspected the particular shapes adopted by the CPT around the DNA through estimates of the chirality index that quantifies the structural changes of CPT upon DNA complexation. Altogether, Molecular Dynamics (MD) simulations, model Hamiltonian calculations of the CD spectra, and the chirality indices provide complimentary insights into the origin of induced chirality from the DNA to the polymer at various scales, which highlights the emergence of hierarchical levels of chirality/symmetry in DNA/CPT complexes.

Resume : A promising approach to influence and control the photophysical properties of conjugated polymers is directing their molecular conformation by templating. We explore here the templating effect of single-stranded DNA oligomers (ssDNAs) on cationic polythiophenes with the goal to uncover the intermolecular interactions that direct the polymer backbone conformation. We have comprehensively characterized the optical behavior and structure of the polythiophenes in conformationally distinct complexes depending on the sequence of nucleic bases and addressed the effect on the ultrafast excited-state relaxation. This, in combination with molecular dynamics simulations, allowed us a detailed atomistic-level understanding of the structure–property correlations. We find that electrostatic and other noncovalent interactions direct the assembly with the polymer, and we identify that optimal templating is achieved with (ideally 10–20) consecutive cytosine bases through numerous π-stacking interactions with the thiophene rings and side groups of the polymer, leading to a rigid assembly with ssDNA, with highly ordered chains and unique optical signatures. Our insights are an important step forward in an effective approach to structural templating and optoelectronic control of conjugated polymers and organic materials in general.

Resume : Many infectious diseases including viruses, bacteria, and toxins, present unique spatial patterns of antigens on their surfaces. These specific patterns facilitate multivalent binding to host cells, resulting in enhanced pathogenic infectivity. Based on this naturally occurring multivalent binding mechanism, synthetic multivalent entry blockers were previously introduced by linking epitopes-binding ligands to a scaffold to improve multivalent binding avidity. However, existing scaffolds, which include polymers, dendrimers, nanofibers, inorganic nanoparticles and lipid nanoemulsions, have shown toxicity. Furthermore, some viruses, such as dengue virus, hepatitis virus, coronaviruses, and influenza viruses, present very complex geometric patterns of epitopes that are needed to match but cannot be addressed by existing scaffolds because they are not as precise in ligand spacing or provide limited control over the scaffold shape and ligand valency. A customizable molecular scaffold strategy capable of incorporating pathogen-specific ligands and patterns may address these issues on both therapeutic and diagnostic fronts. DNA, when folded into nanostructures with a specific shape, is capable of spacing and arranging binding sites into a complex geometric pattern with nanometer-precision. In this study, we demonstrate a designer DNA nanostructure that can act as a template to display multiple binding motifs with precise spatial pattern-recognition properties, and that this approach can confer exceptional sensing and potent viral inhibitory capabilities. A star-shaped DNA architecture, carrying 5 molecular beacon-like motifs, was constructed to display 10 dengue envelope protein domain III (ED3)-targeting aptamers into a two-dimensional pattern precisely matching the spatial arrangement of ED3 clusters on the dengue (DENV) viral surface. The resulting multivalent interactions provide high DENV-binding avidity. We show this structure is a potent viral inhibitor and that it can act as a sensor by including a fluorescent output to report binding. Our molecular-platform design strategy could be adapted to detect and combat other disease-causing pathogens by generating the requisite ligand patterns on customized DNA nanoarchitectures.

Resume : With increasing demands for alternative sources of fuel, extensive research has focused on discovering methods to generate renewable energy from earth abundant resources. In recent years, a wide range of inorganic nanostructures with high surface areas and tunable band gaps have been synthesized and used as photocatalysts. To increase their activity, “Z-scheme” photocatalytic systems have been implemented in which multiple types of photoactive materials simultaneously oxidize water and reduce molecules upon photoillumination. In this talk, I will show our recent efforts to utilize DNA as a structure-directing agent to organize well-defined photoactive donor and acceptor nanocrystals into optimal configurations. In the first part, I will demonstrate that using DNA as a structure directing agent to assemble TiO2 and Pt decorated CdS nanocrystals caused a significant improvement in water splitting as opposed to utilizing a single type of particle or simply mixing the particles in solution. In addition, DNA also allowed positioning of a single or series of electron mediators site-specifically between the two catalysts to further increase H2 production. In a similar vein, I will also show some of our recent efforts in applying Z-schemes for reducing CO2 to usable fuels. In the latter part of the talk, I will showcase our very recent efforts to apply a bioinspired approach to tailor protein-nanoparticle interfaces for studying photoassisted redox activity. In order to drive enzymatic reduction of dissolved gases, electron sources such as photocatalysts and electrochemistry have been studied. However, in order to optimize electron flow, there is a significant need to understand how the interface between the organic enzyme and inorganic semiconductor influences protein binding and dynamics. Many redox enzymes function through assembly of protein subunits utilizing complex and multivalent interactions, with binding strengths ranging from long-range and weak to short-range and near-covalent. Mimicking such exquisite binding motifs is likely to be key for replacing protein subunits with photoactive semiconductors. This talk will showcase our recent insight into the design of interfaces between semiconductor surfaces and proteins to control binding and conformational dynamics of enzymes to promote photodriven redox catalytic activities